The DNA sequencing service is intended for all customers in universities, research institutes and companies. We are performing both conventional Sanger sequencing and high-throughput sequencing. The source material should be good quality DNA or RNA. Contact petri.auvinen@helsinki.fi or martyn.james@helsinki.fi for more information.
You need to be registered to iLab in order to be able to do an order request. If you already have an iLab account you are able to use the ordering system directly.
How to register for an iLab account:
Please start using iLab from now on.
In case you need any assistance or help during registration or ordering - contact
Pia Laine (pia.k.laine@helsinki.fi) and Martyn James (martyn.james@helsinki.fi).
Best regards,
Martyn James, Pia Laine
DNA Genomics and Sequencing
Sanger sequencing is a classical and widely used small scale DNA sequencing method. It requires a known primer, normal deoxynucleosidetriphosphates (dNTPs) and modified di-deoxynucleotidetriphopates (ddNTPs) and a DNA polymerase for obtaining >500 bp long sequence.
We sequence plasmids, PCR products and larger templates like cosmids, phages, BACs or PACs. It’s possible to use custom primers (5 pmol/µl) or you can choose from our common primers list.
Service protocol:
PCR products have been purified by Milliporen MultiScreen PCR 96. (Cat No. LSKMPCR50)
Applied Biosystems BigDye Terminator v3.1 Cycle Sequencing Kit (Part No. 4336921). The sequencing reactions have been made by using the protocol recommended by manifacturer.
Sequencing reactions with Applied Biosystems ABI3130XL Genetic Analyzer (16-capillaries).
We have a fragment analysis service where customers can bring us ready-made labelled samples. The service includes cleaning of the sample, fragment analysis run by 3130xl and the size standard. Possibility of digestion for labelled PCR products is also available. Cleaning of the samples, if necessary, is done either by Millipore 96 PCR purification plate or using Agencourt AmPure chemistry. We perform a preliminary analysis to check that the run was completed properly and that the size standard works. Analysing of the samples is done by the customer. Recommended analysis software for our customers is the Peak Scanner which is available at Applied Biosystems website.
Fragment sets:
Filter set D (ds-30) 6-FAM, HEX, NED
ABI 3130 size std ROX
Filter set G5 (ds02) dR110, dR6G, dTAMRA,
ABI 3130 dROX and size std LIZ
We currently have the following size standards:
GeneScan 1000 ROX, GeneScan 500 ROX and GeneScan 120 LIZ from Applied Biosystems. MapMaker 1000 ROX from BioVentures.
Short read sequencers
iSeq 100, MiSeq and NovaSeq (Illumina)
ISeq and MiSeq are both Illumina’s NGS (next-generation sequencing) systems that uses sequencing-by-synthesis (SBS) chemistry. Both have their advantages and therefore sequencing system is selected based on the customer's need. MiSeq produces longer paired end reads (2X~300 bp, ~20*106 - 40*106 read pairs/run) depending on the used sequencing kits. iSeq 100 sequencing system is suitable for small and low throughput sequencing projects. MiSeq is used mainly for amplicon sequencing, eg. bacterial 16S rRNA or fungal ITS, and small microbial sequencing followed by assembly or mapping to reference sequence. NovaSeq is used for large sequencing projects.
AVITI from Element Biosciences is the newest short read benchtop sequencer in house. It has has two independent sequencers in one and four flow cells in total. Avidity sequencing employs rolling circle amplification (RCA) to minimize common amplification errors and therefore it has the industry-leading accuracy (>90% >Q30) in its data.
Long read sequencers
PacBio Revio (Pacific Biosciences)
PacBio Revio instrument by Pacific Biosciences represent our “third-generation sequencing” technology in which single molecules are sequenced. We updated Sequel II instrument to Revio in early 2024. The Revio System has 3X higher data throughput than its predecessor at the same cost. The Revio system adds affordability, high throughput, and ease of use to a foundation of long reads, exceptional accuracy, and direct methylation detection. PacBio HiFi long read sequencing is suitable for whole genome sequencing, targeted sequencing, RNA sequencing, epigenetics and microbiome + metagenomic sequencing.
Promethion-2-Solo (Oxford Nanopore)
Promethion-2-Solo is a small benchtop real-time sequencer from Oxford Nanopore. We purchased this instrument in spring 2023 and so far we have been sequencing direct RNA and ultra-high molecular weight DNA.
NanoString nCounter (NanoString technologies)
This approach uses single molecule probes to identify DNA, RNA or proteins in samples. One can detect up the 800 genes (RNA) in one assay mixing both miRNA and mRNA in one assay. For RNA detection total RNA (100 ng) is enough for simultaneous detection of all the probes in one assay. No cDNA phase needed single molecule detection is made using a scanner build for the purpose.
In common use:
Genome sequencing projects have changed their nature since the invention of the NGS machines 454, Solid and Illumina. We initiated sequencing genomes using 454 GS20 in late 2006 targeting microbe genomes first. Thereafter the rapid development of sequencing technologies has continuously enlarged the scope of genomes that can be assembled using current approaches. Parallel to the DNA sequencing developments also the related bioinformatics approaches has made it possible to handle and take advantage of the newly created data.
For de novo genome sequencing projects the genome size usually dictates the approach one needs to take. Approximately 10 years ago microbes genomes were still assembled using a hybrid of so called short read technologies including matepair libraries and possible PacBio long reads assembled as a hybrid. Now most of the microbe genomes can be assembled using the PacBio long read technology together with suitable bioinformatics approaches. Fungal genomes up to several megabases can also be assembled using PacBio data. Though high-molecular weight DNA sample is still needed in order to get long continuous DNA sequences. More complex eukaryotic genomes can also be assembled using PacBio Revio (Sequel II) long HiFi data.
Fosmid clones and Bac clones can be assemble using short read or long read technologies but they are used rarely today. However, very complex genomes like some plants still benefit of the bac clones that can usually be assembled using PacBio and Oxford Nanopore long reads. When the average sequencing length has increased similarly the ability to resolve repeats has increased. In cases the Sanger sequencing is still used in the validation steps when NGS data cannot resolve some details in the genome.
During the last few years population genetics of sc. non model species has increased in popularity. Due to the large and fast turnaround time of short read (AVITI or Novaseq) resequencing of also eukaryotic genomes can be reached. When smaller genome are studied Miseq give a good choice due to longer reads thus ending up with better assemblies and higher mapping percentage for genomes.
We have an impressive capacity of hardware for scientific computing at our use. The lab internal server system consists of about 10 high performance computing nodes. Of these, four have 1TB (1,000 gigabytes) of Random Access Memory both with 64 processors. With these resources, we are most capable of running any foreseeable bioinformatics computing job as well as web services for collaborative purposes such as BLAST or WebApollo.
Our computing resources are also supplemented by those provided by the Finnish IT Center for Science (CSC).
We advise you to trim adapter sequences from your Illumina reads before any further analysis. We have the most experience from cutadapt program (cutadapt wiki | link to publication)
Sequences to trim from Illumina single-end or paired-end reads:
TruSeq library
R1 read: AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
R2 read: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG
Nextera library
R1&R2 reads: CTGTCTCTTATACACATCT